Universal adaptors are short sequences that are added to each end of the gene fragment during our synthesis. Fragments without these adapters are also available with slightly different pricing. Fragments with adapters are compatible with multiple assembly methods, including restriction digest/ligation, Gateway, Golden Gate, and TOPO cloning.
Sequence |
Length |
GC% |
Tm(°C) |
|
| 5'-adapter | CACGACTACAGTGAATAGGCAAGCG | 25 | 52.0 | 59.5 |
| 3'-adapter | GGATAGCATGCCAGTCTAGACAACG | 25 | 52.0 | 59.1 |
| 5'-CACGACTACAGTGAATAGGCAAGCG-GeneFragment-GGATAGCATGCCAGTCTAGACAACG-3' | ||||